slc39a13

Ensembl ID:
ENSDARG00000000442
ZFIN ID:
ZDB-GENE-030616-17
Description:
Zinc transporter ZIP13 [Source:UniProtKB/Swiss-Prot;Acc:Q8AW42]
Human Orthologue:
SLC39A13
Human Description:
solute carrier family 39 (zinc transporter), member 13 [Source:HGNC Symbol;Acc:20859]
Mouse Orthologue:
Slc39a13
Mouse Description:
solute carrier family 39 (metal ion transporter), member 13 Gene [Source:MGI Symbol;Acc:MGI:1915677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31578 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113245 Nonsense 7 389 1 9
ENSDART00000121972 Nonsense 7 389 2 10
Genomic Location (Zv9):
Chromosome 7 (position 34030388)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32424728
GRCz11 7 32695878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGGCTTATTTCTGCTCTACAGCATCCATGTATCTTCCAAGTGCTT[T/A]GCGGAGGTCTGGGCTGATGAGCGCAGGACCAGAGAGGCCCGTTTGGGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link