zgc:63767

Ensembl ID:
ENSDARG00000000384
ZFIN ID:
ZDB-GENE-040426-1047
Description:
solute carrier family 15 member 4 [Source:RefSeq peptide;Acc:NP_957251]
Human Orthologue:
SLC15A4
Human Description:
solute carrier family 15, member 4 [Source:HGNC Symbol;Acc:23090]
Mouse Orthologue:
Slc15a4
Mouse Description:
solute carrier family 15, member 4 Gene [Source:MGI Symbol;Acc:MGI:2140796]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41259 Essential Splice Site Mutation detected in F1 DNA During 2018
sa18451 Nonsense Available for shipment Available now
sa25401 Nonsense Mutation detected in F1 DNA During 2018
sa34450 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Essential Splice Site 114 501 3 10
ENSDART00000076101   None 240 None 5
ENSDART00000128499 Essential Splice Site 168 428 3 11
Genomic Location (Zv9):
Chromosome 8 (position 37374458)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36230605
GRCz11 8 35959953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGAGTGGGAGCTGTCAAATCAAATATCACTCCATTCGGGGCAGATCAG[G/A]TAATGCAGGGGTGTAAGAGTTGAATTTTGGGGGCCCTCAGAGGGCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Nonsense 129 501 4 10
ENSDART00000076101   None 240 None 5
ENSDART00000128499 Nonsense 183 428 4 11
Genomic Location (Zv9):
Chromosome 8 (position 37365219)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36221366
GRCz11 8 35950714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACAGGYGAARGATCGAGGTCCTGAAGCAACGCGGCGGTTCTTTAACT[G/A]GTTCTACTGGTGCATTAATCTTGGAGCGATCTTCTCTCTGGGTGGTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Nonsense 254 501 5 10
ENSDART00000076101 Nonsense 43 240 1 5
ENSDART00000128499 Nonsense 308 428 5 11
Genomic Location (Zv9):
Chromosome 8 (position 37359885)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36216032
GRCz11 8 35945380
KASP Assay ID:
554-7854.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCGCTGGTTAAAATACTTCCTGTTTTCCTGGCCCTCATTCCATACTG[G/A]ACTGTCTATTTCCAGGTAAGGCTACTATACATCTTTCAGATCTGTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061691 Essential Splice Site 259 501 5 10
ENSDART00000076101 Essential Splice Site 48 240 1 5
ENSDART00000128499 Essential Splice Site 313 428 5 11
Genomic Location (Zv9):
Chromosome 8 (position 37359868)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36216015
GRCz11 8 35945363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCCTGTTTTCCTGGCCCTCATTCCATACTGGACTGTCTATTTCCAGG[T/C]AAGGCTACTATACATCTTTCAGATCTGTCAGCTATTAAAAAAAAGGGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic lupus erythematosus: Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. (View Study)
  • Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link