
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:63767
- Ensembl ID:
- ENSDARG00000000384
- ZFIN ID:
- ZDB-GENE-040426-1047
- Description:
- solute carrier family 15 member 4 [Source:RefSeq peptide;Acc:NP_957251]
- Human Orthologue:
- SLC15A4
- Human Description:
- solute carrier family 15, member 4 [Source:HGNC Symbol;Acc:23090]
- Mouse Orthologue:
- Slc15a4
- Mouse Description:
- solute carrier family 15, member 4 Gene [Source:MGI Symbol;Acc:MGI:2140796]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41259 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18451 | Nonsense | Available for shipment | Available now |
sa25401 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34450 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41259
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061691 | Essential Splice Site | 114 | 501 | 3 | 10 |
ENSDART00000076101 | None | 240 | None | 5 | |
ENSDART00000128499 | Essential Splice Site | 168 | 428 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 37374458)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 36230605 GRCz11 8 35959953 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGGAGTGGGAGCTGTCAAATCAAATATCACTCCATTCGGGGCAGATCAG[G/A]TAATGCAGGGGTGTAAGAGTTGAATTTTGGGGGCCCTCAGAGGGCAGCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18451
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061691 | Nonsense | 129 | 501 | 4 | 10 |
ENSDART00000076101 | None | 240 | None | 5 | |
ENSDART00000128499 | Nonsense | 183 | 428 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 37365219)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 36221366 GRCz11 8 35950714 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTACAGGYGAARGATCGAGGTCCTGAAGCAACGCGGCGGTTCTTTAACT[G/A]GTTCTACTGGTGCATTAATCTTGGAGCGATCTTCTCTCTGGGTGGTATAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25401
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061691 | Nonsense | 254 | 501 | 5 | 10 |
ENSDART00000076101 | Nonsense | 43 | 240 | 1 | 5 |
ENSDART00000128499 | Nonsense | 308 | 428 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 37359885)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 36216032 GRCz11 8 35945380 - KASP Assay ID:
- 554-7854.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAATCGCTGGTTAAAATACTTCCTGTTTTCCTGGCCCTCATTCCATACTG[G/A]ACTGTCTATTTCCAGGTAAGGCTACTATACATCTTTCAGATCTGTCAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34450
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061691 | Essential Splice Site | 259 | 501 | 5 | 10 |
ENSDART00000076101 | Essential Splice Site | 48 | 240 | 1 | 5 |
ENSDART00000128499 | Essential Splice Site | 313 | 428 | 5 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 37359868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 36216015 GRCz11 8 35945363 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTTCCTGTTTTCCTGGCCCTCATTCCATACTGGACTGTCTATTTCCAGG[T/C]AAGGCTACTATACATCTTTCAGATCTGTCAGCTATTAAAAAAAAGGGAGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Systemic lupus erythematosus: Genome-wide association study in a Chinese Han population identifies nine new susceptibility loci for systemic lupus erythematosus. (View Study)
- Systemic lupus erythematosus: Meta-analysis followed by replication identifies loci in or near CDKN1B, TET3, CD80, DRAM1, and ARID5B as associated with systemic lupus erythematosus in Asians. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: