zgc:136850

Ensembl ID:
ENSDARG00000000369
ZFIN ID:
ZDB-GENE-060421-6938
Description:
AMP-activated protein kinase, non-catalytic gamma-3 subunit [Source:RefSeq peptide;Acc:NP_001035456
Human Orthologue:
PRKAG3
Human Description:
protein kinase, AMP-activated, gamma 3 non-catalytic subunit [Source:HGNC Symbol;Acc:9387]
Mouse Orthologue:
Prkag3
Mouse Description:
protein kinase, AMP-activated, gamma 3 non-catatlytic subunit Gene [Source:MGI Symbol;Acc:MGI:189134

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34588 Nonsense Available for shipment Available now
sa31707 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007497   None 336 1 13
ENSDART00000135209 Nonsense 3 342 1 13

The following transcripts of ENSDARG00000000369 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14385051)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14137616
GRCz11 9 14108819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCTCGGCTCAGGACAGATCGAACACTAAACGCATTCGGCTAATGCTG[G/T]GACCCCAAACCATGGACCCTCTGACAGAGGTAAGACCCTGAGATCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007497 Essential Splice Site 7 336 2 13
ENSDART00000135209 Essential Splice Site 13 342 2 13

The following transcripts of ENSDARG00000000369 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 14382470)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14135035
GRCz11 9 14106238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTTTTTTATCCTGTTTCCTTAGTTAAAATCTTTATTTTGTGTTTTA[G/A]TTCCCTTTTATGGAGGATGAGGGGCTCACCATGAAGAGGACAGGTATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link