
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:136850
- Ensembl ID:
- ENSDARG00000000369
- ZFIN ID:
- ZDB-GENE-060421-6938
- Description:
- AMP-activated protein kinase, non-catalytic gamma-3 subunit [Source:RefSeq peptide;Acc:NP_001035456
- Human Orthologue:
- PRKAG3
- Human Description:
- protein kinase, AMP-activated, gamma 3 non-catalytic subunit [Source:HGNC Symbol;Acc:9387]
- Mouse Orthologue:
- Prkag3
- Mouse Description:
- protein kinase, AMP-activated, gamma 3 non-catatlytic subunit Gene [Source:MGI Symbol;Acc:MGI:189134
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34588 | Nonsense | Available for shipment | Available now |
sa31707 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34588
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007497 | None | 336 | 1 | 13 | |
ENSDART00000135209 | Nonsense | 3 | 342 | 1 | 13 |
The following transcripts of ENSDARG00000000369 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 14385051)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 14137616 GRCz11 9 14108819 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGCTCGGCTCAGGACAGATCGAACACTAAACGCATTCGGCTAATGCTG[G/T]GACCCCAAACCATGGACCCTCTGACAGAGGTAAGACCCTGAGATCAAACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31707
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000007497 | Essential Splice Site | 7 | 336 | 2 | 13 |
ENSDART00000135209 | Essential Splice Site | 13 | 342 | 2 | 13 |
The following transcripts of ENSDARG00000000369 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 14382470)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 14135035 GRCz11 9 14106238 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCTTTTTTTATCCTGTTTCCTTAGTTAAAATCTTTATTTTGTGTTTTA[G/A]TTCCCTTTTATGGAGGATGAGGGGCTCACCATGAAGAGGACAGGTATCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: