zgc:92061

Ensembl ID:
ENSDARG00000000212
ZFIN ID:
ZDB-GENE-040718-78
Description:
hypothetical protein LOC436656 [Source:RefSeq peptide;Acc:NP_001002383]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24099 Nonsense Available for shipment Available now
sa37450 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37451 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105808 Nonsense 129 438 1 8
Genomic Location (Zv9):
Chromosome 22 (position 11866632)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11726800
GRCz11 22 11756482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGTACGATAAGAGGACCCCAGTTTCCAGAGACTACAGCCACTATTA[T/A]GTCACCATTGAAGATCTGCGCAAGAAAGTAAGTGATTATATAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105808 Essential Splice Site 138 438 1 8
Genomic Location (Zv9):
Chromosome 22 (position 11866661)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11726829
GRCz11 22 11756511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGACTACAGCCACTATTATGTCACCATTGAAGATCTGCGCAAGAAAG[T/C]AAGTGATTATATAAAATATATTGGATTTAGACACATTTTACAAATTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105808 Nonsense 308 438 5 8
Genomic Location (Zv9):
Chromosome 22 (position 11868393)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11728561
GRCz11 22 11758243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGTAATGAAATCAACGAACTCAGGAGAACATTGCAGGCTCTGGAGATC[G/T]AACTACAGTCACAGCTTAGCCTGGTAAACGTTCTTAGCAATATGTAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link