si:rp71-1n7.1

Ensembl ID:
ENSDARG00000000189
ZFIN ID:
ZDB-GENE-040724-119
Description:
Novel protein similar to human semaphorin 6D (SEMA6D) [Source:UniProtKB/TrEMBL;Acc:Q7T165]
Human Orthologue:
SEMA6C
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C [Source:HGNC Symbol;
Mouse Orthologue:
Sema6c
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C Gene [Source:MGI Sym

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36170 Nonsense Mutation detected in F1 DNA During 2018
sa42750 Nonsense Mutation detected in F1 DNA During 2018
sa14024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000198 Nonsense 388 1064 11 18
ENSDART00000135723 Nonsense 351 538 10 14
Genomic Location (Zv9):
Chromosome 16 (position 32557381)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30283894
GRCz11 16 30204760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTCCAGGCCAGGGTCGTGTGCTGGTGATGGCCCTGCTGCTGGTTA[C/A]AAGTCCTCCACAAATTTCCCTGATGAGACTCTTACCTTCATTAAGTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000198 Nonsense 418 1064 11 18
ENSDART00000135723 Nonsense 381 538 10 14
Genomic Location (Zv9):
Chromosome 16 (position 32557469)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30283982
GRCz11 16 30204848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTAAGTCTTATCCACTAATGGACGAGGCTGTGCCGTCTGTCAACAAC[C/T]GACCCTGCTTCACACGAACCACCAGCAGGTTCGCACACAAACACACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000198 Nonsense 481 1064 12 18
ENSDART00000135723 Nonsense 444 538 11 14
Genomic Location (Zv9):
Chromosome 16 (position 32557903)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 30284416
GRCz11 16 30205282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCAAACTCCTCGTACAGCAYTCAGGTTTTGGAGGACATCGATGTTTA[C/A]AACCCTAACAAGTGAGTTAGAGAGCAAATATGCACACTSTTTTTGATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link