si:dkey-266k12.1

Ensembl ID:
ENSDARG00000000161
ZFIN ID:
ZDB-GENE-041014-84
Description:
Novel protein similar to human and mouse intersectin 2 (ITSN2) [Source:UniProtKB/TrEMBL;Acc:Q5RI29]
Human Orthologue:
ITSN2
Human Description:
intersectin 2 [Source:HGNC Symbol;Acc:6184]
Mouse Orthologue:
Itsn2
Mouse Description:
intersectin 2 Gene [Source:MGI Symbol;Acc:MGI:1338049]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23703 Nonsense Available for shipment Available now
sa6632 Nonsense Mutation detected in F1 DNA During 2018
sa11816 Essential Splice Site Available for shipment Available now
sa23702 Nonsense Available for shipment Available now
sa17221 Nonsense Available for shipment Available now
sa43439 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44939 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43438 Nonsense Mutation detected in F1 DNA During 2018
sa44938 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 48 1418 1 30
ENSDART00000062780 Nonsense 239 1639 7 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25422889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25494192
GRCz11 20 25393282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGTACCGACAACTGTTTAACAGCCTGGACAAGCTAATGAGTGGATA[C/A]CTGTCAGGTGAGTTTATGTGTGTGTAGATCGCAGGAAGAAGAGGGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 65 1418 2 30
ENSDART00000062780 Nonsense 256 1639 8 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25422721)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25494024
GRCz11 20 25393114
KASP Assay ID:
554-4824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGAAGGTCCCCAGGTCAGAAATGCCCTCACAGCTTCAAACCTCACA[C/T]AAACACAGCTTGCCACTATATGGTGAGTTCACACAACACTGCTTTCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Essential Splice Site 118 1418 4 30
ENSDART00000062780 Essential Splice Site 309 1639 10 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25421617)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25492920
GRCz11 20 25392010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACAAGWTATGAAGGAGACTGTGTTTATTCTGTGCCTATAWTTGTTTTC[A/T]GAACAACTAAGTCATGTGACCTGCTAAACGGACCTGTTCCTCTGATTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 235 1418 5 30
ENSDART00000062780 Nonsense 426 1639 11 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25420828)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25492131
GRCz11 20 25391221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGAGAGAGGAGGAGCGCAGGATGGAGAGACAGAGAGAGCTGGAGCGA[C/T]AGAGAGAGGAGGAACGACTGAAAGAATTAGAGCGGCGAGAGGCAAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 591 1418 12 30
ENSDART00000062780 Nonsense 772 1639 18 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25405193)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25476496
GRCz11 20 25375586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCCCTTCACTGCACGCAACTCAGACGAGCTCACGCTGGAGGCAGACTG[T/A]TTCATCCAGGTGCATATGGCACTCRTGCGGTTTTAAAGTGGACCTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Essential Splice Site 649 1418 13 30
ENSDART00000062780 Essential Splice Site 830 1639 19 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25404469)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25475772
GRCz11 20 25374862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACCGCAGCTGAAACTGAGTCCACTGCGCCCTCTGCCAACTACCCTGGG[T/G]ATGACAAAATCAAACTTCTCCAATCTTTGAAAATGTATATAATATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Essential Splice Site 819 1418 17 30
ENSDART00000062780 Essential Splice Site 1040 1639 25 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25400583)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25471886
GRCz11 20 25370976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGTGCTGCATAAGAACTCAAACAGCTGGTGGCTTGGTGAACTACAG[G/A]TCAGCACATCACTTTACCTAACCGTATGTCTATTGTGCATTAAAGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 1139 1418 24 30
ENSDART00000062780 Nonsense 1360 1639 32 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25393356)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25464659
GRCz11 20 25363749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAACTCCGACCGACTGGAGTGGATCCAGAACCACGTGTTGTGTGAC[G/T]GAGTCATTGAGGTGAAACACTGTTGTAAAGCTCCACCATGACCTCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000170 Nonsense 1210 1418 25 30
ENSDART00000062780 Nonsense 1431 1639 33 38
ENSDART00000143558   None 173 None 5

The following transcripts of ENSDARG00000000161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 25393045)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25464348
GRCz11 20 25363438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCAGACAAACTCTTCAATCCCAACTCCAACACACAGTACAAGATGTA[C/A]AAGACGGTATGGCAACAACACTGCTTATGAGATTAAATTTGTAGGATTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link