ube2h

Ensembl ID:
ENSDARG00000000019
ZFIN ID:
ZDB-GENE-030616-67
Description:
ubiquitin-conjugating enzyme E2 H [Source:RefSeq peptide;Acc:NP_958897]
Human Orthologue:
UBE2H
Human Description:
ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) [Source:HGNC Symbol;Acc:12484]
Mouse Orthologues:
Gm2058, Ube2h
Mouse Descriptions:
predicted gene 2058 Gene [Source:MGI Symbol;Acc:MGI:3805010]
ubiquitin-conjugating enzyme E2H Gene [Source:MGI Symbol;Acc:MGI:104632]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33431 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33431
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000020 Essential Splice Site 18 183 1 7
ENSDART00000124452 Essential Splice Site 18 183 1 7
Genomic Location (Zv9):
Chromosome 4 (position 14076906)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15012759
GRCz11 4 15011514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTCCAAGTCCGGGCAAAAGACGAATGGACACCGACGTGGTGAAACTG[T/C]ATCCTTTAAAATATAAACAACACAATTACTGTAACGCTGTGGCCGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link