ccdc80

Ensembl ID:
ENSDARG00000000002
ZFIN ID:
ZDB-GENE-030616-56
Description:
Coiled-coil domain-containing protein 80 [Source:UniProtKB/Swiss-Prot;Acc:Q90X49]
Human Orthologue:
CCDC80
Human Description:
coiled-coil domain containing 80 [Source:HGNC Symbol;Acc:30649]
Mouse Orthologue:
Ccdc80
Mouse Description:
coiled-coil domain containing 80 Gene [Source:MGI Symbol;Acc:MGI:1915146]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44707 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000000005 Essential Splice Site 552 867 1 7
Genomic Location (Zv9):
Chromosome 9 (position 35062117)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34281628
GRCz11 9 34090813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTGGCAACCTTTTTGGACTATTTTGAAAGCAGGAGGAGATTAATTG[T/C]GAGTAGTCTTGGTAATAGTATTAATTAAAATGTGGATTTTGTTGTTATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link