ID: 997602326 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:135149237-135149259 |
| Sequence | CTCTATTAAGAGAGAGAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 425 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 38, 4: 385} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 997602320_997602326 | 15 | Left | 997602320 | 5:135149199-135149221 | CCAAGAGCAACCGTCTTTAAATG | 0: 1 1: 0 2: 1 3: 9 4: 100 |
||
| Right | 997602326 | 5:135149237-135149259 | CTCTATTAAGAGAGAGAAGAAGG | 0: 1 1: 0 2: 1 3: 38 4: 385 |
||||
| 997602324_997602326 | 5 | Left | 997602324 | 5:135149209-135149231 | CCGTCTTTAAATGGGCATGGACC | 0: 1 1: 0 2: 0 3: 6 4: 106 |
||
| Right | 997602326 | 5:135149237-135149259 | CTCTATTAAGAGAGAGAAGAAGG | 0: 1 1: 0 2: 1 3: 38 4: 385 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 997602326 | Original CRISPR | CTCTATTAAGAGAGAGAAGA AGG | Intronic | ||