ID: 996897280

View in Genome Browser
Species Human (GRCh38)
Location 5:128500378-128500400
Sequence CTATATCATTTGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996897280 Original CRISPR CTATATCATTTGAGGGAAGA GGG (reversed) Intronic