ID: 996266642 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:121549221-121549243 |
Sequence | CTGAATTAGTGGAGGAAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
996266642_996266645 | 7 | Left | 996266642 | 5:121549221-121549243 | CCTTCTTTCCTCCACTAATTCAG | No data | ||
Right | 996266645 | 5:121549251-121549273 | TCAATGCTAGCTCACTGTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
996266642 | Original CRISPR | CTGAATTAGTGGAGGAAAGA AGG (reversed) | Intergenic | ||