ID: 986482000 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:8198854-8198876 |
| Sequence | CTGTATTTCTACAGAGAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986481996_986482000 | 30 | Left | 986481996 | 5:8198801-8198823 | CCAGTGGCTCAACATGACTTTCT | No data | ||
| Right | 986482000 | 5:8198854-8198876 | CTGTATTTCTACAGAGAAGATGG | No data | ||||
| 986481999_986482000 | -7 | Left | 986481999 | 5:8198838-8198860 | CCATCAAGGTCATGCTCTGTATT | No data | ||
| Right | 986482000 | 5:8198854-8198876 | CTGTATTTCTACAGAGAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986482000 | Original CRISPR | CTGTATTTCTACAGAGAAGA TGG | Intergenic | ||