ID: 983884805 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:172968505-172968527 |
Sequence | CTTTTTTTGTAGAGGGAGGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 769 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 63, 4: 701} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
983884805_983884810 | 22 | Left | 983884805 | 4:172968505-172968527 | CCCTCCTCCCTCTACAAAAAAAG | 0: 1 1: 0 2: 4 3: 63 4: 701 |
||
Right | 983884810 | 4:172968550-172968572 | CAATCTAAAATATAACACTGAGG | 0: 1 1: 0 2: 2 3: 23 4: 300 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
983884805 | Original CRISPR | CTTTTTTTGTAGAGGGAGGA GGG (reversed) | Intronic | ||