ID: 980383749 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:132060525-132060547 |
Sequence | CTGCCTTTGAAGAGGGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
980383749 | Original CRISPR | CTGCCTTTGAAGAGGGAAGA AGG | Intergenic | ||