ID: 979799876 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:124895038-124895060 |
Sequence | CTGTATTAGTGGAGGCAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
979799868_979799876 | 10 | Left | 979799868 | 4:124895005-124895027 | CCACTGCCTAGTGATAAAGACAT | No data | ||
Right | 979799876 | 4:124895038-124895060 | CTGTATTAGTGGAGGCAAAATGG | No data | ||||
979799869_979799876 | 4 | Left | 979799869 | 4:124895011-124895033 | CCTAGTGATAAAGACATCACCCC | No data | ||
Right | 979799876 | 4:124895038-124895060 | CTGTATTAGTGGAGGCAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
979799876 | Original CRISPR | CTGTATTAGTGGAGGCAAAA TGG | Intergenic | ||