ID: 970982514 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:22117253-22117275 |
| Sequence | CTGTAATAGCAGAGGGGAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 970982510_970982514 | -7 | Left | 970982510 | 4:22117237-22117259 | CCACACATATGTGTAACTGTAAT | No data | ||
| Right | 970982514 | 4:22117253-22117275 | CTGTAATAGCAGAGGGGAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 970982514 | Original CRISPR | CTGTAATAGCAGAGGGGAAA AGG | Intergenic | ||