ID: 970548015 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:17149208-17149230 |
Sequence | CTGTATCAGTAGAGTGAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
970548014_970548015 | -6 | Left | 970548014 | 4:17149191-17149213 | CCTAGTCTCAGGTATGTCTGTAT | No data | ||
Right | 970548015 | 4:17149208-17149230 | CTGTATCAGTAGAGTGAAAATGG | No data | ||||
970548012_970548015 | 6 | Left | 970548012 | 4:17149179-17149201 | CCTCTTTTTCTTCCTAGTCTCAG | No data | ||
Right | 970548015 | 4:17149208-17149230 | CTGTATCAGTAGAGTGAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
970548015 | Original CRISPR | CTGTATCAGTAGAGTGAAAA TGG | Intergenic | ||