ID: 967343741 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:188429660-188429682 |
Sequence | CTCTATTATGAAAGGGAAGA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 315 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 26, 4: 288} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
967343741_967343745 | 18 | Left | 967343741 | 3:188429660-188429682 | CCGTCTTCCCTTTCATAATAGAG | 0: 1 1: 0 2: 0 3: 26 4: 288 |
||
Right | 967343745 | 3:188429701-188429723 | CTCGTCTTCTTTTCTTTAAGCGG | 0: 1 1: 0 2: 1 3: 22 4: 258 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
967343741 | Original CRISPR | CTCTATTATGAAAGGGAAGA CGG (reversed) | Intronic | ||