ID: 964814051 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:160697701-160697723 |
Sequence | CAGTATGAGTAGAGTGAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
964814049_964814051 | 9 | Left | 964814049 | 3:160697669-160697691 | CCTGGTGAAGGTGACATTTGAGT | No data | ||
Right | 964814051 | 3:160697701-160697723 | CAGTATGAGTAGAGTGAAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
964814051 | Original CRISPR | CAGTATGAGTAGAGTGAAAA TGG | Intergenic | ||