ID: 964265736 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:154893484-154893506 |
Sequence | CTGTCTTATTAGAGGGCAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
964265736_964265740 | -3 | Left | 964265736 | 3:154893484-154893506 | CCACCTGCCCTCTAATAAGACAG | No data | ||
Right | 964265740 | 3:154893504-154893526 | CAGCAATTCTTCAGCTCTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
964265736 | Original CRISPR | CTGTCTTATTAGAGGGCAGG TGG (reversed) | Intergenic | ||