ID: 958989990 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:100831705-100831727 |
| Sequence | CTGGATGAGTAGAGGGATGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 618 | |||
| Summary | {0: 1, 1: 1, 2: 3, 3: 61, 4: 552} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 958989990_958989996 | 5 | Left | 958989990 | 3:100831705-100831727 | CCCTCATCCCTCTACTCATCCAG | 0: 1 1: 1 2: 3 3: 61 4: 552 |
||
| Right | 958989996 | 3:100831733-100831755 | ATGCTGGTTTCTAATTATCCTGG | 0: 1 1: 0 2: 0 3: 11 4: 131 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 958989990 | Original CRISPR | CTGGATGAGTAGAGGGATGA GGG (reversed) | Intronic | ||