ID: 955871995 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:63449092-63449114 |
| Sequence | CAGTATTGGGAGAGGAAAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 459 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 41, 4: 414} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955871991_955871995 | -6 | Left | 955871991 | 3:63449075-63449097 | CCATTCTCATTCTTGGACAGTAT | 0: 1 1: 0 2: 0 3: 16 4: 219 |
||
| Right | 955871995 | 3:63449092-63449114 | CAGTATTGGGAGAGGAAAGAAGG | 0: 1 1: 0 2: 3 3: 41 4: 414 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955871995 | Original CRISPR | CAGTATTGGGAGAGGAAAGA AGG | Intronic | ||