ID: 955393337 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:58536901-58536923 |
Sequence | CTGTGTTAGTAGCAGGGAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 299 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 22, 4: 274} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955393337_955393341 | -9 | Left | 955393337 | 3:58536901-58536923 | CCATCTCCCTGCTACTAACACAG | 0: 1 1: 0 2: 2 3: 22 4: 274 |
||
Right | 955393341 | 3:58536915-58536937 | CTAACACAGAAACTGCAAGAGGG | 0: 1 1: 0 2: 1 3: 27 4: 350 |
||||
955393337_955393342 | -5 | Left | 955393337 | 3:58536901-58536923 | CCATCTCCCTGCTACTAACACAG | 0: 1 1: 0 2: 2 3: 22 4: 274 |
||
Right | 955393342 | 3:58536919-58536941 | CACAGAAACTGCAAGAGGGCCGG | 0: 1 1: 0 2: 3 3: 38 4: 440 |
||||
955393337_955393340 | -10 | Left | 955393337 | 3:58536901-58536923 | CCATCTCCCTGCTACTAACACAG | 0: 1 1: 0 2: 2 3: 22 4: 274 |
||
Right | 955393340 | 3:58536914-58536936 | ACTAACACAGAAACTGCAAGAGG | 0: 1 1: 1 2: 2 3: 65 4: 648 |
||||
955393337_955393343 | -4 | Left | 955393337 | 3:58536901-58536923 | CCATCTCCCTGCTACTAACACAG | 0: 1 1: 0 2: 2 3: 22 4: 274 |
||
Right | 955393343 | 3:58536920-58536942 | ACAGAAACTGCAAGAGGGCCGGG | 0: 1 1: 0 2: 3 3: 42 4: 379 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955393337 | Original CRISPR | CTGTGTTAGTAGCAGGGAGA TGG (reversed) | Intronic | ||