ID: 953302102

View in Genome Browser
Species Human (GRCh38)
Location 3:41787515-41787537
Sequence CTGAATTGGCAGGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953302102 Original CRISPR CTGAATTGGCAGGGGGAAGA AGG (reversed) Intronic