ID: 951806492 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:26649928-26649950 |
Sequence | CTGGATAAGTAGAGGGAAAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 360 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 20, 4: 336} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
951806492_951806496 | 4 | Left | 951806492 | 3:26649928-26649950 | CCTCTTTCCCTCTACTTATCCAG | 0: 1 1: 0 2: 3 3: 20 4: 336 |
||
Right | 951806496 | 3:26649955-26649977 | ATTTCATCTTTTTAAGACCCAGG | 0: 1 1: 0 2: 3 3: 33 4: 356 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
951806492 | Original CRISPR | CTGGATAAGTAGAGGGAAAG AGG (reversed) | Intronic | ||