ID: 951090051 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:18561889-18561911 |
| Sequence | CTGTAATAGTTGAGTCAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951090051_951090054 | 19 | Left | 951090051 | 3:18561889-18561911 | CCTTCTTGACTCAACTATTACAG | No data | ||
| Right | 951090054 | 3:18561931-18561953 | TTTTTCTTCCCTTCTCAATTTGG | No data | ||||
| 951090051_951090055 | 20 | Left | 951090051 | 3:18561889-18561911 | CCTTCTTGACTCAACTATTACAG | No data | ||
| Right | 951090055 | 3:18561932-18561954 | TTTTCTTCCCTTCTCAATTTGGG | No data | ||||
| 951090051_951090053 | -9 | Left | 951090051 | 3:18561889-18561911 | CCTTCTTGACTCAACTATTACAG | No data | ||
| Right | 951090053 | 3:18561903-18561925 | CTATTACAGGCTCACTACTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951090051 | Original CRISPR | CTGTAATAGTTGAGTCAAGA AGG (reversed) | Intergenic | ||