ID: 950598566 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:14009277-14009299 |
Sequence | CTGTAATAGGAGATGGAACA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 449 | |||
Summary | {0: 1, 1: 4, 2: 33, 3: 117, 4: 294} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950598566_950598569 | -2 | Left | 950598566 | 3:14009277-14009299 | CCGTGTTCCATCTCCTATTACAG | 0: 1 1: 4 2: 33 3: 117 4: 294 |
||
Right | 950598569 | 3:14009298-14009320 | AGTTCCTCAAAGACGTGCTCAGG | 0: 1 1: 0 2: 1 3: 11 4: 80 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950598566 | Original CRISPR | CTGTAATAGGAGATGGAACA CGG (reversed) | Intronic | ||