ID: 947331674 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:229035455-229035477 |
Sequence | GTGTGTGAGTAGAGGGAAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1002 | |||
Summary | {0: 1, 1: 0, 2: 7, 3: 98, 4: 896} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
947331674_947331678 | -9 | Left | 947331674 | 2:229035455-229035477 | CCTCCTTCCCTCTACTCACACAC | 0: 1 1: 0 2: 7 3: 98 4: 896 |
||
Right | 947331678 | 2:229035469-229035491 | CTCACACACATACATATAAATGG | 0: 1 1: 2 2: 34 3: 286 4: 1630 |
||||
947331674_947331680 | -7 | Left | 947331674 | 2:229035455-229035477 | CCTCCTTCCCTCTACTCACACAC | 0: 1 1: 0 2: 7 3: 98 4: 896 |
||
Right | 947331680 | 2:229035471-229035493 | CACACACATACATATAAATGGGG | 0: 1 1: 0 2: 53 3: 330 4: 1580 |
||||
947331674_947331679 | -8 | Left | 947331674 | 2:229035455-229035477 | CCTCCTTCCCTCTACTCACACAC | 0: 1 1: 0 2: 7 3: 98 4: 896 |
||
Right | 947331679 | 2:229035470-229035492 | TCACACACATACATATAAATGGG | 0: 1 1: 0 2: 13 3: 188 4: 1082 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
947331674 | Original CRISPR | GTGTGTGAGTAGAGGGAAGG AGG (reversed) | Intronic | ||