ID: 941918779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:170829074-170829096 |
| Sequence | CTGTATAAGCAGAAGGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 429 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 45, 4: 381} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941918779_941918783 | -6 | Left | 941918779 | 2:170829074-170829096 | CCCTCCTCCTTCTGCTTATACAG | 0: 1 1: 0 2: 2 3: 45 4: 381 |
||
| Right | 941918783 | 2:170829091-170829113 | ATACAGCCCATAAACAGTGCTGG | 0: 1 1: 0 2: 0 3: 2 4: 126 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941918779 | Original CRISPR | CTGTATAAGCAGAAGGAGGA GGG (reversed) | Intronic | ||