ID: 941584764 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:167343828-167343850 |
| Sequence | CTGTATTAGAAGGGGAAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941584759_941584764 | 13 | Left | 941584759 | 2:167343792-167343814 | CCTCTGTATCTTCAGGTTTTAGT | No data | ||
| Right | 941584764 | 2:167343828-167343850 | CTGTATTAGAAGGGGAAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941584764 | Original CRISPR | CTGTATTAGAAGGGGAAAGA TGG | Intergenic | ||