ID: 931285869 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:60831054-60831076 |
Sequence | CTGTATTAGTAAAGTTGAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931285869_931285874 | 2 | Left | 931285869 | 2:60831054-60831076 | CCCTCTCAACTTTACTAATACAG | No data | ||
Right | 931285874 | 2:60831079-60831101 | AAGTTCAGGACTGAGGAATGTGG | No data | ||||
931285869_931285873 | -5 | Left | 931285869 | 2:60831054-60831076 | CCCTCTCAACTTTACTAATACAG | No data | ||
Right | 931285873 | 2:60831072-60831094 | TACAGGTAAGTTCAGGACTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931285869 | Original CRISPR | CTGTATTAGTAAAGTTGAGA GGG (reversed) | Intergenic | ||