ID: 929304173 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:40341058-40341080 |
| Sequence | ATGGAGTAGTAGAGAGAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 742 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 56, 4: 682} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929304167_929304173 | 27 | Left | 929304167 | 2:40341008-40341030 | CCATAGTGGAGAAAGCATTTGAA | 0: 1 1: 0 2: 1 3: 30 4: 242 |
||
| Right | 929304173 | 2:40341058-40341080 | ATGGAGTAGTAGAGAGAAGAGGG | 0: 1 1: 0 2: 3 3: 56 4: 682 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929304173 | Original CRISPR | ATGGAGTAGTAGAGAGAAGA GGG | Intronic | ||