ID: 921879846

View in Genome Browser
Species Human (GRCh38)
Location 1:220243572-220243594
Sequence CTGAAAAAGTAGATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 560}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921879846 Original CRISPR CTGAAAAAGTAGATGGAAGA TGG (reversed) Intronic