ID: 921862715 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:220056012-220056034 |
| Sequence | CTCCATTCGTAGAGGGAAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921862712_921862715 | -2 | Left | 921862712 | 1:220055991-220056013 | CCACTATTTACAGATAGAGAACT | No data | ||
| Right | 921862715 | 1:220056012-220056034 | CTCCATTCGTAGAGGGAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921862715 | Original CRISPR | CTCCATTCGTAGAGGGAAGC AGG | Intergenic | ||