ID: 916477600 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:165185255-165185277 |
| Sequence | CTGAATTAGTTGAGGGCAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916477600_916477606 | 0 | Left | 916477600 | 1:165185255-165185277 | CCTACTGCCCTCAACTAATTCAG | No data | ||
| Right | 916477606 | 1:165185278-165185300 | GACACAAGGAGGTTACTAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916477600 | Original CRISPR | CTGAATTAGTTGAGGGCAGT AGG (reversed) | Intergenic | ||