ID: 910787419 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:91015474-91015496 |
| Sequence | GACTATTAGTAGAGAGAAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 284 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 16, 4: 264} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910787419_910787423 | 9 | Left | 910787419 | 1:91015474-91015496 | CCTTCTTCTCTCTACTAATAGTC | 0: 1 1: 0 2: 3 3: 16 4: 264 |
||
| Right | 910787423 | 1:91015506-91015528 | CCTCACAGTCAAAAATTGAAAGG | 0: 1 1: 0 2: 1 3: 15 4: 156 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910787419 | Original CRISPR | GACTATTAGTAGAGAGAAGA AGG (reversed) | Intronic | ||