ID: 910724297 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:90322498-90322520 |
| Sequence | ATGGATTGGTAGAGAGAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910724294_910724297 | -4 | Left | 910724294 | 1:90322479-90322501 | CCAGATTTTGAAGGAGATGATGG | No data | ||
| Right | 910724297 | 1:90322498-90322520 | ATGGATTGGTAGAGAGAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910724297 | Original CRISPR | ATGGATTGGTAGAGAGAAGA TGG | Intergenic | ||