ID: 905600723

View in Genome Browser
Species Human (GRCh38)
Location 1:39248186-39248208
Sequence ATGTTTTAGTAGAAAGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905600723_905600725 9 Left 905600723 1:39248186-39248208 CCGTCTTCTTTCTACTAAAACAT 0: 1
1: 0
2: 1
3: 54
4: 540
Right 905600725 1:39248218-39248240 CTCCAAGTCCCGTTTCTTCGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905600723 Original CRISPR ATGTTTTAGTAGAAAGAAGA CGG (reversed) Intronic