ID: 904124754

View in Genome Browser
Species Human (GRCh38)
Location 1:28230318-28230340
Sequence CTGTTTTCATAGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904124754 Original CRISPR CTGTTTTCATAGAGTGAAGA GGG (reversed) Intronic