ID: 901563305 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:10090511-10090533 |
| Sequence | CTGTAAAAGAGGAGGGAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 880 | |||
| Summary | {0: 1, 1: 0, 2: 13, 3: 144, 4: 722} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901563301_901563305 | -8 | Left | 901563301 | 1:10090496-10090518 | CCTAGATATTCTTATCTGTAAAA | 0: 1 1: 2 2: 17 3: 202 4: 1672 |
||
| Right | 901563305 | 1:10090511-10090533 | CTGTAAAAGAGGAGGGAAGATGG | 0: 1 1: 0 2: 13 3: 144 4: 722 |
||||
| 901563300_901563305 | 20 | Left | 901563300 | 1:10090468-10090490 | CCTAAGGGAAGTTTTTAGACTCT | 0: 1 1: 0 2: 2 3: 12 4: 212 |
||
| Right | 901563305 | 1:10090511-10090533 | CTGTAAAAGAGGAGGGAAGATGG | 0: 1 1: 0 2: 13 3: 144 4: 722 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901563305 | Original CRISPR | CTGTAAAAGAGGAGGGAAGA TGG | Intronic | ||