ID: 1190391430 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:49935596-49935618 |
Sequence | CTGAATTTATAGAGAGAAGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1190391429_1190391430 | 0 | Left | 1190391429 | X:49935573-49935595 | CCTATGAAAAAGAATAGTAGAGA | No data | ||
Right | 1190391430 | X:49935596-49935618 | CTGAATTTATAGAGAGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1190391430 | Original CRISPR | CTGAATTTATAGAGAGAAGA AGG | Intronic | ||