ID: 1185086303 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:48742771-48742793 |
Sequence | GTGTATTAGAAGAGGAGAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185086296_1185086303 | 22 | Left | 1185086296 | 22:48742726-48742748 | CCGGCAGCACAGTGGAGCAGGCA | No data | ||
Right | 1185086303 | 22:48742771-48742793 | GTGTATTAGAAGAGGAGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185086303 | Original CRISPR | GTGTATTAGAAGAGGAGAGA TGG | Intronic | ||