ID: 1183259209 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:36783417-36783439 |
Sequence | TTCTATTTGCAGAGGGAAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183259209_1183259215 | 11 | Left | 1183259209 | 22:36783417-36783439 | CCTTCTTCCCTCTGCAAATAGAA | No data | ||
Right | 1183259215 | 22:36783451-36783473 | CTCTTCCATCTAATGTACTTTGG | No data | ||||
1183259209_1183259217 | 16 | Left | 1183259209 | 22:36783417-36783439 | CCTTCTTCCCTCTGCAAATAGAA | No data | ||
Right | 1183259217 | 22:36783456-36783478 | CCATCTAATGTACTTTGGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183259209 | Original CRISPR | TTCTATTTGCAGAGGGAAGA AGG (reversed) | Intergenic | ||