ID: 1182750490 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:32637973-32637995 |
| Sequence | CTGAACTACTAAAGGGAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182750490_1182750494 | 22 | Left | 1182750490 | 22:32637973-32637995 | CCCTCTTCCCTTTAGTAGTTCAG | No data | ||
| Right | 1182750494 | 22:32638018-32638040 | GTCCGTGAGTACTTCATGTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182750490 | Original CRISPR | CTGAACTACTAAAGGGAAGA GGG (reversed) | Intronic | ||