ID: 1169846367 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:9996572-9996594 |
| Sequence | CTGTCTTGGTAGAGAGAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1169846361_1169846367 | 12 | Left | 1169846361 | 20:9996537-9996559 | CCCAGAAGTGCACACAGATGAGG | No data | ||
| Right | 1169846367 | 20:9996572-9996594 | CTGTCTTGGTAGAGAGAACAGGG | No data | ||||
| 1169846363_1169846367 | 11 | Left | 1169846363 | 20:9996538-9996560 | CCAGAAGTGCACACAGATGAGGC | 0: 1 1: 0 2: 1 3: 14 4: 151 |
||
| Right | 1169846367 | 20:9996572-9996594 | CTGTCTTGGTAGAGAGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1169846367 | Original CRISPR | CTGTCTTGGTAGAGAGAACA GGG | Intronic | ||