ID: 1165312487 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:35037249-35037271 |
Sequence | CTGTGTTAGGAGAAGGCAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 600 | |||
Summary | {0: 1, 1: 0, 2: 4, 3: 40, 4: 555} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1165312477_1165312487 | 25 | Left | 1165312477 | 19:35037201-35037223 | CCTGGAAGAGGTGGAGAAGATGC | 0: 1 1: 0 2: 2 3: 32 4: 333 |
||
Right | 1165312487 | 19:35037249-35037271 | CTGTGTTAGGAGAAGGCAGATGG | 0: 1 1: 0 2: 4 3: 40 4: 555 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1165312487 | Original CRISPR | CTGTGTTAGGAGAAGGCAGA TGG | Intronic | ||