ID: 1149518966 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:57303958-57303980 |
Sequence | CTGAATTACTAGAGGGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 486 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 111, 4: 366} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1149518955_1149518966 | 8 | Left | 1149518955 | 17:57303927-57303949 | CCTTGAGAGAGTCCCTCAAGCAT | 0: 1 1: 0 2: 1 3: 16 4: 143 |
||
Right | 1149518966 | 17:57303958-57303980 | CTGAATTACTAGAGGGAGGAGGG | 0: 1 1: 0 2: 8 3: 111 4: 366 |
||||
1149518959_1149518966 | -4 | Left | 1149518959 | 17:57303939-57303961 | CCCTCAAGCATGGGAGGACCTGA | 0: 1 1: 0 2: 4 3: 75 4: 357 |
||
Right | 1149518966 | 17:57303958-57303980 | CTGAATTACTAGAGGGAGGAGGG | 0: 1 1: 0 2: 8 3: 111 4: 366 |
||||
1149518960_1149518966 | -5 | Left | 1149518960 | 17:57303940-57303962 | CCTCAAGCATGGGAGGACCTGAA | 0: 1 1: 0 2: 0 3: 11 4: 167 |
||
Right | 1149518966 | 17:57303958-57303980 | CTGAATTACTAGAGGGAGGAGGG | 0: 1 1: 0 2: 8 3: 111 4: 366 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1149518966 | Original CRISPR | CTGAATTACTAGAGGGAGGA GGG | Intronic | ||