ID: 1147904976 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:43816726-43816748 |
| Sequence | CAGCATTAGTGGAGGGAAGC GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 228 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 11, 4: 214} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147904969_1147904976 | 27 | Left | 1147904969 | 17:43816676-43816698 | CCTTTGTCACAAGGCTGATCATC | 0: 1 1: 0 2: 1 3: 6 4: 129 |
||
| Right | 1147904976 | 17:43816726-43816748 | CAGCATTAGTGGAGGGAAGCGGG | 0: 1 1: 0 2: 2 3: 11 4: 214 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147904976 | Original CRISPR | CAGCATTAGTGGAGGGAAGC GGG | Intronic | ||