ID: 1140800873 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:78487368-78487390 |
| Sequence | TTGTATTAGTAGATGGGATA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 481 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 468} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140800873_1140800877 | 18 | Left | 1140800873 | 16:78487368-78487390 | CCGTATCCCATCTACTAATACAA | 0: 1 1: 0 2: 0 3: 12 4: 468 |
||
| Right | 1140800877 | 16:78487409-78487431 | GGATGAGTCCACAAGTTTGAAGG | 0: 1 1: 0 2: 2 3: 6 4: 116 |
||||
| 1140800873_1140800876 | -3 | Left | 1140800873 | 16:78487368-78487390 | CCGTATCCCATCTACTAATACAA | 0: 1 1: 0 2: 0 3: 12 4: 468 |
||
| Right | 1140800876 | 16:78487388-78487410 | CAAACTAATGAGATCTATTAAGG | 0: 1 1: 0 2: 2 3: 20 4: 199 |
||||
| 1140800873_1140800878 | 19 | Left | 1140800873 | 16:78487368-78487390 | CCGTATCCCATCTACTAATACAA | 0: 1 1: 0 2: 0 3: 12 4: 468 |
||
| Right | 1140800878 | 16:78487410-78487432 | GATGAGTCCACAAGTTTGAAGGG | 0: 1 1: 0 2: 0 3: 5 4: 110 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140800873 | Original CRISPR | TTGTATTAGTAGATGGGATA CGG (reversed) | Intronic | ||