ID: 1138361295

View in Genome Browser
Species Human (GRCh38)
Location 16:56430598-56430620
Sequence CAGTATTAGAAGAGGGTATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138361295 Original CRISPR CAGTATTAGAAGAGGGTATA AGG (reversed) Exonic